| |
---|
Cell line: | HEK293T-DDX6-null |
DSMZ no.: | ACC 873 |
Species: | human (Homo sapiens) |
Cell type: | embryonal kidney |
Origin: | this cell line is part of a set of cell line models carrying mutations in different genes affecting mRNA processing and translation efficiency (ACC 872 - ACC 876).
Single clone derivative of 293T (DSMZ ACC 635) which was modified by CRISPR/CAS9 editing.
In this cell line the ORF of three allels of the DDX6 (Dead-box helicase 6) gene on chr 11 was disrupted by random insertions and deletions in exon 3.
Cells are described to contain a reduced number of P-bodies as compared to the parental cell line 293T. |
Reference(s): | 18207, 18216 |
Biosafety level: | 1, GMO-S1 |
Risk assessment: | genetically modified organism, according to German and European legislation allocated into group S1
(see also parental 293T, DSMZ ACC 635) |
Permissions and restrictions: | A, D |
Depositor-specific restrictions: | Transfer to third parties needs to be negotiated with the depositor. |
| DSMZ Cell Culture Data: |
Morphology: | fibroblastoid cells growing adherently as monolayer; image; image |
Medium: | 90% DMEM + 10% h.i. FBS + 2mM L-glutamine |
Subculture: | seed out at about 1 x 106 cells/80 cm2; split (semi-)confluent culture 1:3 to 1:5 every 3-4 days by tapping the flask (trypsin/EDTA is not necessary) |
Incubation: | at 37 °C with 10% CO2 |
Doubling time: | ca. 30-40 hours |
Harvest: | cell harvest of ca. 5 x 106 cells/80 cm2 flask |
Storage: | frozen with 70% medium, 20% FBS, 10% DMSO |
| DSMZ Scientific Data: |
Mycoplasma: | negative in PCR assay |
Immunology: | to inquire about expression of EpCAM and intermediate filaments, contact ulfert.rand@dsmz.de. |
Authenticity: | STR analysis according to the global standard ANSI/ATCC ASN-0002.1-2021 (2021) resulted in an authentic STR profile of the reference STR database. |
Molec. Genetics: | disruption of the DDX6 gene was verified by sequence analysis as described in Ref 18207 (Sgromo et al 2018). For internal control the following primers can be used D-DDX6-F:
GGGTTGGAGGAGGAGGGTGGCA and D-DDX6-R: CCTCCTGAGATTCTCTATAAGAACACTT.
Absence of the DDX6 protein was confirmed by Western blot. |
Viruses: | PCR: EBV -, HBV -, HCV -, HIV-1 -, HIV-2 -, HTLV-1/2 -, MLV - |
Supplied as: | Delivery form | | Prices | | Frozen culture | | 450,- € | Growing culture (please inquire for exact delivery time) | | 900,- € | DNA isolated from cell line (25 µg) | | 560,- € | DNA isolated from cell line (5 µg) | | 140,- € | see price list |
| Print data sheet |